Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3080588
End position: 3080620
Length: 33

DNA sequence
>NC_008705, from 3080588 to 3080620 (33 bp); Mycobacterium sp. KMS GAGCGCCCCGGGAGCCACCCGGTAGCGGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3080499-3081050	Sequence	Mkms_2946 - type 12 methyltransferase (Protein is coded in complementary strand; from 3081050 to 3080499)