Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 301295
End position: 301318
Length: 24

DNA sequence
>NC_008705, from 301295 to 301318 (24 bp); Mycobacterium sp. KMS TCGGCCTCGTCCTCGGACTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 300290-302236	Sequence	Mkms_0263 sdhA succinate dehydrogenase flavoprotein subunit (Protein is coded in complementary strand; from 302236 to 300290)