Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 2654408
End position: 2654431
Length: 24

DNA sequence
>NC_008705, from 2654408 to 2654431 (24 bp); Mycobacterium sp. KMS GCGGCGGCGGCGTCGGCGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2654207-2655058	Sequence	Mkms_2524 - hypothetical protein (Protein is coded in complementary strand; from 2655058 to 2654207)