Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 2582060
End position: 2582083
Length: 24

DNA sequence
>NC_008705, from 2582060 to 2582083 (24 bp); Mycobacterium sp. KMS CCGCGGCGGCGGCCACGGCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2582041-2584134	Sequence	Mkms_2460 - transketolase (Protein is coded in complementary strand; from 2584134 to 2582041)