Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 2441392
End position: 2441415
Length: 24

DNA sequence
>NC_008705, from 2441392 to 2441415 (24 bp); Mycobacterium sp. KMS CCGACGCCGACAGCGACGCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2440212-2441513	Sequence	Mkms_2328 - ErfK/YbiS/YcfS/YnhG family protein (Protein is coded in complementary strand; from 2441513 to 2440212)