Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 2389569
End position: 2389604
Length: 36

DNA sequence
>NC_008705, from 2389569 to 2389604 (36 bp); Mycobacterium sp. KMS CGGTCTCGCCACCGGTGTCCCCACCGGTCTCGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2389547-2391451	Sequence	Mkms_2281 - hypothetical protein (Protein is coded in complementary strand; from 2391451 to 2389547)