Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 2222044
End position: 2222073
Length: 30

DNA sequence
>NC_008705, from 2222044 to 2222073 (30 bp); Mycobacterium sp. KMS CTCGCCGCCGGTCGCGGCCGCCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2221652-2223436	Sequence	Mkms_2100 - N-acetyltransferase GCN5 (Protein is coded in complementary strand; from 2223436 to 2221652)