Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 2092124
End position: 2092150
Length: 27

DNA sequence
>NC_008705, from 2092124 to 2092150 (27 bp); Mycobacterium sp. KMS GACCGCCGCGACCGCGGCGGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2091654-2092310	Sequence	Mkms_1972 - hypothetical protein (Protein is coded in complementary strand; from 2092310 to 2091654)