Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 2017557
End position: 2017608
Length: 52

DNA sequence
>NC_008705, from 2017557 to 2017608 (52 bp); Mycobacterium sp. KMS GGTCAGACCACTCGATCAAACCACTCGGTCATACCACTCGGTCATACCACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2017599-2019035	Sequence	Mkms_1901 - GntR family transcriptional regulator (Protein is coded in complementary strand; from 2019035 to 2017599)