Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 180606
End position: 180629
Length: 24

DNA sequence
>NC_008705, from 180606 to 180629 (24 bp); Mycobacterium sp. KMS CCGGCGCCGCCGCCGACGCCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 179019-181013	Sequence	Mkms_0166 - PgPepO oligopeptidase (Protein is coded in complementary strand; from 181013 to 179019)