Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 1618617
End position: 1618661
Length: 45

DNA sequence
>NC_008705, from 1618617 to 1618661 (45 bp); Mycobacterium sp. KMS CGGCGGTGGTGGCGGAGGCGGAGGTGCCGGCGGTGGAGGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1618612-1621107	Sequence	Mkms_1505 - glycosyl transferase family protein (Protein is coded in complementary strand; from 1621107 to 1618612)