Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 1510942
End position: 1510965
Length: 24

DNA sequence
>NC_008705, from 1510942 to 1510965 (24 bp); Mycobacterium sp. KMS GACGCCGACGGCGGCGCCGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1510914-1512437	Sequence	Mkms_1411 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 1512437 to 1510914)