Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 1301585
End position: 1301629
Length: 45

DNA sequence
>NC_008705, from 1301585 to 1301629 (45 bp); Mycobacterium sp. KMS CCGCGGCGGCGATGTCGGCGACGCCGATGTCCGCGGTGGCGTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1301344-1302300	Sequence	Mkms_1217 - helix-turn-helix domain-containing protein (Protein is coded in complementary strand; from 1302300 to 1301344)