Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 1298076
End position: 1298102
Length: 27

DNA sequence
>NC_008705, from 1298076 to 1298102 (27 bp); Mycobacterium sp. KMS CGGGCCGATCGGGCCGGTCGGGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1298045-1298410	Sequence	Mkms_1213 - hypothetical protein (Protein is coded in complementary strand; from 1298410 to 1298045)