Sequence retrieval

Genome: Shewanella amazonensis SB2B
Start position: 4026833
End position: 4026874
Length: 42

DNA sequence
>NC_008700, from 4026833 to 4026874 (42 bp); Shewanella amazonensis SB2B GTCTGGGTCTGGGTCTGGGTCTGGGTCTGGGTCTGGGTCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4026371-4026946	Sequence	Sama_3399 - hypothetical protein (Protein is coded in complementary strand; from 4026946 to 4026371)