Sequence retrieval

Genome: Shewanella amazonensis SB2B
Start position: 2957356
End position: 2957391
Length: 36

DNA sequence
>NC_008700, from 2957356 to 2957391 (36 bp); Shewanella amazonensis SB2B TAGTGCTGGGCTTAGTGCTGGGCTTAGTGCTGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2957271-2959796	Sequence	Sama_2453 - 1,4-alpha-glucan-branching protein (Protein is coded in complementary strand; from 2959796 to 2957271)