Sequence retrieval

Genome: Shewanella amazonensis SB2B
Start position: 2705059
End position: 2705100
Length: 42

DNA sequence
>NC_008700, from 2705059 to 2705100 (42 bp); Shewanella amazonensis SB2B ACCATTCACCATTCACCATTCACCATTCACCATTCACCATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2705086-2706219	Sequence	Sama_2242 - dTDP-glucose 4,6-dehydratase (Protein is coded in complementary strand; from 2706219 to 2705086)