Sequence retrieval

Genome: Shewanella amazonensis SB2B
Start position: 2698930
End position: 2698957
Length: 28

DNA sequence
>NC_008700, from 2698930 to 2698957 (28 bp); Shewanella amazonensis SB2B CTAGATTCTAGATTCTAGATTCTAGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2698333-2698941	Sequence	Sama_2234 - lipoprotein NlpE involved in copper resistance