Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1404595
End position: 1404649
Length: 55

DNA sequence
>NC_008699, from 1404595 to 1404649 (55 bp); Nocardioides sp. JS614 GGTCAGCGCGGGGCCAGCGCCGGGTCAGCGCGGGGTCAGCGCGGGGTCAGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1404642-1406141	Sequence	Noca_1335 - FAD dependent oxidoreductase (Protein is coded in complementary strand; from 1406141 to 1404642)