Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4949767
End position: 4949820
Length: 54

DNA sequence
>NC_008699, from 4949767 to 4949820 (54 bp); Nocardioides sp. JS614 ACGTCGAACGGGTGGCTCACGTCGAAGGGGTGGCTCACGTCGAACGGGTGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4948702-4950297	Sequence	Noca_4670 - peptidase S8/S53 subtilisin kexin sedolisin (Protein is coded in complementary strand; from 4950297 to 4948702)