Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4834456
End position: 4834509
Length: 54

DNA sequence
>NC_008699, from 4834456 to 4834509 (54 bp); Nocardioides sp. JS614 GGCCGAGCCGCCTGAGCCGCCTGAGCCGCCCGAGCCGCCCGAGCCGCCGGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4834292-4835815	Sequence	Noca_4567 - DEAD/DEAH box helicase domain-containing protein (Protein is coded in complementary strand; from 4835815 to 4834292)