Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4110447
End position: 4110500
Length: 54

DNA sequence
>NC_008699, from 4110447 to 4110500 (54 bp); Nocardioides sp. JS614 GGCGGCCTTCTTGGCCGGGGCAGCCTTCTTCGCGGGCGCCGCCTTCTTGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4109815-4110594	Sequence	Noca_3904 - 50S ribosomal protein L4P (Protein is coded in complementary strand; from 4110594 to 4109815)