Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2105423
End position: 2105473
Length: 51

DNA sequence
>NC_008699, from 2105423 to 2105473 (51 bp); Nocardioides sp. JS614 GCCTGCTCACTCGAACGGCCGGCTCATTCGGACGGCCGGCTCATTCGGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2105193-2105423	Sequence	Noca_1975 - hypothetical protein
ORF... 2105464-2105679	Sequence	Noca_1976 - hypothetical protein (Protein is coded in complementary strand; from 2105679 to 2105464)