Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4597926
End position: 4597973
Length: 48

DNA sequence
>NC_008699, from 4597926 to 4597973 (48 bp); Nocardioides sp. JS614 GCCGTCCAGGTCGCCGTCGGGGTCGCCGTCGGGGTCGCCGTCCGGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4597924-4598406	Sequence	Noca_4348 - hypothetical protein (Protein is coded in complementary strand; from 4598406 to 4597924)