Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4481557
End position: 4481604
Length: 48

DNA sequence
>NC_008699, from 4481557 to 4481604 (48 bp); Nocardioides sp. JS614 GCCCGGGCGGCGGCCCGGGCGGCGGCTCGTGCGGCGGCTCGGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4481437-4482297	Sequence	Noca_4243 - hypothetical protein (Protein is coded in complementary strand; from 4482297 to 4481437)