Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4272925
End position: 4272972
Length: 48

DNA sequence
>NC_008699, from 4272925 to 4272972 (48 bp); Nocardioides sp. JS614 GCCCGACTCGGCGCCGGACTCCGCGCCGGACTCGGGGCCGGACTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4272881-4273480	Sequence	Noca_4049 - hypothetical protein (Protein is coded in complementary strand; from 4273480 to 4272881)