Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3886083
End position: 3886130
Length: 48

DNA sequence
>NC_008699, from 3886083 to 3886130 (48 bp); Nocardioides sp. JS614 CTACCTGCCGTAGGAGCTACCTGCCGTAGGAGCTACCTGCCGTAGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3886116-3886592	Sequence	Noca_3662 - 30S ribosomal protein S18 (Protein is coded in complementary strand; from 3886592 to 3886116)