Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4629392
End position: 4629436
Length: 45

DNA sequence
>NC_008699, from 4629392 to 4629436 (45 bp); Nocardioides sp. JS614 TCGCGTCGCCGTCGGTCCCGTCCCCGTCGGTCCCGTCGGCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4629319-4629543	Sequence	Noca_4379 - hypothetical protein (Protein is coded in complementary strand; from 4629543 to 4629319)