Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4629240
End position: 4629284
Length: 45

DNA sequence
>NC_008699, from 4629240 to 4629284 (45 bp); Nocardioides sp. JS614 CAACTCGAGGGCAGGCAGCTCCCGGGCAGGCAGCTCGCGGGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4628107-4629318	Sequence	Noca_4378 - cupin 4 family protein (Protein is coded in complementary strand; from 4629318 to 4628107)