Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 453170
End position: 453214
Length: 45

DNA sequence
>NC_008699, from 453170 to 453214 (45 bp); Nocardioides sp. JS614 CTGAGCTGCTCGGGGCTGAGTCGCTCGGGGCTGAGTCGCTCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 453119-454018	Sequence	Noca_0422 - HemK family modification methylase (Protein is coded in complementary strand; from 454018 to 453119)