Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4358657
End position: 4358701
Length: 45

DNA sequence
>NC_008699, from 4358657 to 4358701 (45 bp); Nocardioides sp. JS614 CCCGCGGCCTCGAACGACGTGGCCTCGAACCCGGCCGCCTCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4358432-4359634	Sequence	Noca_4127 - extracellular ligand-binding receptor (Protein is coded in complementary strand; from 4359634 to 4358432)