Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4222790
End position: 4222834
Length: 45

DNA sequence
>NC_008699, from 4222790 to 4222834 (45 bp); Nocardioides sp. JS614 GCTGCTCGCGGCCGGCCTCCTTGCGGCCGGCCTCCTTGCGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4222714-4223904	Sequence	Noca_4001 - PE-PGRS family protein (Protein is coded in complementary strand; from 4223904 to 4222714)