Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4092237
End position: 4092281
Length: 45

DNA sequence
>NC_008699, from 4092237 to 4092281 (45 bp); Nocardioides sp. JS614 GCCGTCTCCTCGGCCACGGTCTCCTCGGCGGGCGCCTCCTCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4092090-4092698	Sequence	Noca_3874 - 50S ribosomal protein L17 (Protein is coded in complementary strand; from 4092698 to 4092090)