Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3820297
End position: 3820341
Length: 45

DNA sequence
>NC_008699, from 3820297 to 3820341 (45 bp); Nocardioides sp. JS614 GCCGCCGACGACCGCGCCGGCGACGACGCCGATGCCGACGATCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3818828-3820384	Sequence	Noca_3602 - chemotaxis sensory transducer (Protein is coded in complementary strand; from 3820384 to 3818828)