Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3670229
End position: 3670273
Length: 45

DNA sequence
>NC_008699, from 3670229 to 3670273 (45 bp); Nocardioides sp. JS614 GAGGCCCGGGGCCCTGAGACCGGGGGGCCTGAGACCGGGGGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3669072-3670313	Sequence	Noca_3461 - rod shape-determining protein RodA (Protein is coded in complementary strand; from 3670313 to 3669072)