Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3661383
End position: 3661427
Length: 45

DNA sequence
>NC_008699, from 3661383 to 3661427 (45 bp); Nocardioides sp. JS614 CGCCCTTCTTGGCGGCGGTCTTCTTGGCAGCGGTCTTCTTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3658808-3662020	Sequence	Noca_3452 - ribonuclease G (Protein is coded in complementary strand; from 3662020 to 3658808)