Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3502470
End position: 3502514
Length: 45

DNA sequence
>NC_008699, from 3502470 to 3502514 (45 bp); Nocardioides sp. JS614 TGCCGGTGCCTTCTTGGCCGGAGCCTTCTTGGCGGGCGCCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3502342-3502950	Sequence	Noca_3296 - nucleoid protein Hbs (Protein is coded in complementary strand; from 3502950 to 3502342)