Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3391101
End position: 3391145
Length: 45

DNA sequence
>NC_008699, from 3391101 to 3391145 (45 bp); Nocardioides sp. JS614 GCCTTCTTCGCCGGCGCCTTCTTGGCGGCCGGCTTCTCGGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3388521-3391337	Sequence	Noca_3190 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 3391337 to 3388521)