Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3093304
End position: 3093348
Length: 45

DNA sequence
>NC_008699, from 3093304 to 3093348 (45 bp); Nocardioides sp. JS614 TCGGCGTTGGACGGCCCAGCGTTGGACGGCTCAGCGTGCGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3092482-3093360	Sequence	Noca_2912 - inositol-phosphate phosphatase (Protein is coded in complementary strand; from 3093360 to 3092482)