Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2771114
End position: 2771158
Length: 45

DNA sequence
>NC_008699, from 2771114 to 2771158 (45 bp); Nocardioides sp. JS614 GGCCGCCTTCTTGGCCGCCGCCTTCTTGGCCGCGGGCTTCTTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2771049-2771708	Sequence	Noca_2605 - hypothetical protein (Protein is coded in complementary strand; from 2771708 to 2771049)