Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 527662
End position: 527703
Length: 42

DNA sequence
>NC_008699, from 527662 to 527703 (42 bp); Nocardioides sp. JS614 CGATGAGCCCGGTCCGATGAGCGAGGTCCGATGAGCGAGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 526010-527668	Sequence	Noca_0496 - uroporphyrinogen-III synthase / uroporphyrinogen-III C-methyltransferase
ORF... 527693-528694	Sequence	Noca_0497 - delta-aminolevulinic acid dehydratase