Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1719490
End position: 1719531
Length: 42

DNA sequence
>NC_008699, from 1719490 to 1719531 (42 bp); Nocardioides sp. JS614 CGTGCCCGTGGCCGTGGCCGTGCCCGTGGCCGTGCCCGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1719444-1720130	Sequence	Noca_1621 - hypothetical protein (Protein is coded in complementary strand; from 1720130 to 1719444)