Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 440551
End position: 440590
Length: 40

DNA sequence
>NC_008699, from 440551 to 440590 (40 bp); Nocardioides sp. JS614 CGGCGCGGCCAGGCGCAGCCCGGCGCCGTCCGGAGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 439817-442225	Sequence	Noca_0408 - thrombospondin type 3 repeat-containing protein (Protein is coded in complementary strand; from 442225 to 439817)