Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1797501
End position: 1797539
Length: 39

DNA sequence
>NC_008699, from 1797501 to 1797539 (39 bp); Nocardioides sp. JS614 GGGGACCGGTCAGCGGGACCGGTCAGCGGGACCGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1797524-1799125	Sequence	Noca_1690 - hypothetical protein (Protein is coded in complementary strand; from 1799125 to 1797524)