Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 734159
End position: 734194
Length: 36

DNA sequence
>NC_008699, from 734159 to 734194 (36 bp); Nocardioides sp. JS614 ACCCCGGAGTCCACTCCGGAGGCCACCCCGGAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 734103-735056	Sequence	Noca_0695 - transcription termination/antitermination factor NusG