Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 712920
End position: 712955
Length: 36

DNA sequence
>NC_008699, from 712920 to 712955 (36 bp); Nocardioides sp. JS614 CGTAGGGCTGCTGGTAGGGCTGCTGGTAGGGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 712565-712987	Sequence	Noca_0673 - hypothetical protein (Protein is coded in complementary strand; from 712987 to 712565)