Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 549677
End position: 549712
Length: 36

DNA sequence
>NC_008699, from 549677 to 549712 (36 bp); Nocardioides sp. JS614 GTGGGCTGGCGGGTGGGCAGGTGGGTGGGCTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 549035-549964	Sequence	Noca_0518 - peptidoglycan binding domain-containing protein (Protein is coded in complementary strand; from 549964 to 549035)