Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4690500
End position: 4690535
Length: 36

DNA sequence
>NC_008699, from 4690500 to 4690535 (36 bp); Nocardioides sp. JS614 CGGCCACCGGGACGGGGACCGGGACGGGCACCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4690478-4691194	Sequence	Noca_4437 - hypothetical protein (Protein is coded in complementary strand; from 4691194 to 4690478)