Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4605470
End position: 4605505
Length: 36

DNA sequence
>NC_008699, from 4605470 to 4605505 (36 bp); Nocardioides sp. JS614 GGCACCGGCCCGGTCACCGGCCCGGTCACCTGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4605026-4606030	Sequence	Noca_4356 - hypothetical protein (Protein is coded in complementary strand; from 4606030 to 4605026)