Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4597840
End position: 4597875
Length: 36

DNA sequence
>NC_008699, from 4597840 to 4597875 (36 bp); Nocardioides sp. JS614 GCTGGGTGCTCGGACGGGTGCTCGGACGGGTGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4596343-4597893	Sequence	Noca_4347 lysS lysyl-tRNA synthetase (Protein is coded in complementary strand; from 4597893 to 4596343)